whole genome crispr knockout grna library  (Addgene inc)

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of ex vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 genome-wide screenings. The screenings were repeated independently once. The p-values were calculated using the α-robust rank aggregation (α-RRA) algorithm in MAGeCK. ( c ) Verification of candidate genes by individual single gRNAs. The relative expression levels of surface PD-1 protein and PD-1 mRNA were measured by FACS as mean fluorescent intensity (MFI) and RT-qPCR, respectively. The verification assays were biologically replicated twice. ( d ) GSEA of significantly enriched KEGG pathways in genome-wide screening. The enrichment score (ES) and statistical significance were calculated using the clusterProfiler (version 3.12.0) R package.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: Ex Vivo, CRISPR, Genome Wide, Expressing, Quantitative RT-PCR

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of in vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 screening. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK. ( c ) Volcano plot showing results of in vivo CRISPR/Cas9 screenings. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: In Vivo, CRISPR, Ex Vivo

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) CRISPR/Cas9 knockout of B4galt1 (sgB4galt1) (sg2) in CD8 + T-cells increases expression of PD-1 before and after co-culture with B16F10-OVA cells. The MFIs of PD-1 were measured by FACS (n=6). The relative mRNA levels of PD-1 were measured by quantitative RT-qPCR (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( b ) The effect of B4galt1 knockout on PD-1 surface expression could be rescued by overexpression of either long- or short-isoform B4galt1 (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( c ) CRISPR/Cas9 knockout of B4galt1 in CD8 + T-cells increases expression of TNFα and IFNγ after co-culture with B16F10-OVA cells. The relative mRNA levels were measured by quantitative RT-qPCR (n=3). The secreted TNFα and IFNγ in medium were measured by ELISA (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 in OT-I CD8 + T-cells increases in vitro specific killing activities on B16F10-OVA cells (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( e ) Schematic view of B4GALT1 knockdown in human NY-ESO-1 TCR-T-cells. ( f ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells by shRNA increases in vitro killing activities on A375 cells (n=5). The p-values were calculated using a two-tailed Student’s t -test. ( g ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells increases expression of TNFα and IFNγ after co-culture with A375 cells. The secreted TNFα and IFNγ in medium were measured by ELISA (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( h ) Heatmap demonstrating differentially expressed genes (DEGs) between B4galt1 knockout and control mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled on the left side. ( i ) Volcano plot showing upregulated and downregulated genes (p-value <0.01) in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled with dark blue and dark red. Top genes and some genes in TCR signaling pathway are annotated. The p-value was calculated using the Wald test, and p.adjust was calculated using Benjamini–Hochberg with the R package DESeq2 (version 1.22.2). ( j ) Bar graph showing KEGG pathways significantly changed in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The p-value was calculated using the clusterProfiler (version 3.12.0) R package. All of these functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: CRISPR, Knock-Out, Expressing, Co-Culture Assay, Quantitative RT-PCR, Two Tailed Test, Over Expression, Enzyme-linked Immunosorbent Assay, In Vitro, Knockdown, shRNA, Control, Labeling, Functional Assay

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: CRISPR/Cas9 knockout of B4GALT1 in hCD19-CAR-T-cells does not affect in vitro killing of Nalm6 target cells (n=3). The killing assays were biologically replicated three times. Data are shown as the mean ± SEM. NS, not significant.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: CRISPR, Knock-Out, In Vitro

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of B4galt1 functional test in tumor microenvironment. ( b ) CRISPR/Cas9 knockout of B4galt1 in OT-I T-cells enhances growth control of B16F10-OVA tumors in vivo. The p-value was calculated using two-way ANOVA. ( c ) Compared with control OT-I T-cells, the tumors were significantly smaller when B4galt1 knockout OT-I T-cells were transplanted (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 increases numbers of OT-I T-cells in B16F10-OVA tumors (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. The in vivo functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: Functional Assay, CRISPR, Knock-Out, Control, In Vivo, Two Tailed Test

Journal: bioRxiv

Article Title: Sub-Millivolt Voltage Imaging Reveals Gap Junction-Mediated Bioelectric Contact Inhibition

doi: 10.64898/2026.02.10.701308

Figure Lengend Snippet: a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Article Snippet: The following guide RNAs (gRNAs) from the human CRISPR knockout pooled library A (GeCKOv2) were cloned into the lentiCRISPRv2 (Addgene #52961): GJA1 (Cx43): 19135: TCAGCGCACCACTGGTCGCA, 19136: TGTGTTCTATGTGATGCGAA GJC1 (Cx45): 19177: CATCTTCCCGAATCCGTCGT, 19179: GCAAGCCCTATGCAATGCGC HEK293T cells were transiently transfected with the lentiCRISPRv2 expression plasmids using Roti®-fect.

Techniques: Western Blot, Knock-Out, Generated, CRISPR, Control, Fluorescence, Stable Transfection, Expressing, Over Expression

Journal: Cell Reports Medicine

Article Title: CDK4/6 inhibition overcomes venetoclax resistance mechanisms with enhanced combination activity in acute myeloid leukemia

doi: 10.1016/j.xcrm.2025.102526

Figure Lengend Snippet: Genetic targeting of protein synthesis pathways sensitizes AML cells to venetoclax (A) Volcano plots of genome-wide CRISPR screen. All 480 genes uniquely sensitizing to ven with no evidence of an effect by combination treatment (non-significant) are shown as black dots. (B–D) Reactome pathways from differential expression analysis (DEA) of the 480 gene set show enrichment in pathways related to cell cycle (B), metabolism of RNA (C), and metabolism of proteins (D). The dot size indicates the number of evaluated genes in the Reactome pathway.

Article Snippet: Virus for sgRNA YUSA library was produced by transfecting HEK 293T/17 cells with Calcium chloride, HEPES buffer saline, VSVG, psPAX2 and human CRISPR library plasmid DNA (Addgene #67989).

Techniques: Genome Wide, CRISPR, Quantitative Proteomics